Review



primer premier 6.0 computer program  (Premier Biosoft)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Premier Biosoft primer premier 6.0 computer program
    Primer Premier 6.0 Computer Program, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/primer+premier+5+0+software/pmc04467265-58-15-20
    Average 90 stars, based on 1 article reviews
    primer premier 6.0 computer program - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Cloning, characterization, and tissue distribution of prolactin receptor in the sea bream (Sparus aurata).
    Article Snippet: .. Specific primers were designed using the Primer Premier computer program (Version 4.04; Premier Biosoft International) based on the sbPRLR sequence. .. Forward primer (PF2) (59AGTCCGGCTGGGTCACCATTA) and reverse primer (PR2) (59GGTGGCGACCAAGATCCAAAAC39) were synthesized by MWG-Biotech GmbH (Germany) and were predicted to amplify a fragment of 249 bp. cDNA was synthesized in a 30-ml reaction as previously described from total RNA (0.5 mg) from the following tissue samples: liver, kidney, intestine, brain, pituitary, skin, gills, heart, skeletal muscle, bone, ovary, and testis.



    Similar Products

    primer premier 6.0 computer program  (Premier Biosoft)
    90
    Premier Biosoft primer premier 6.0 computer program
    Primer Premier 6.0 Computer Program, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/primer+premier+5+0+software/pmc04467265-58-15-20
    Average 90 stars, based on 1 article reviews
    primer premier 6.0 computer program - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program 'primer premier mini  (Premier Biosoft)
    90
    Premier Biosoft computer program 'primer premier mini
    Computer Program 'Primer Premier Mini, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+program+primer+premier+for+windows/10__1080_slash_03235400903308883-101-10-13
    Average 90 stars, based on 1 article reviews
    computer program 'primer premier mini - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program primer premier 5.0  (Premier Biosoft)
    90
    Premier Biosoft computer program primer premier 5.0
    Computer Program Primer Premier 5.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+software+primer+premier+5+0/pmc02845116-57-15-20
    Average 90 stars, based on 1 article reviews
    computer program primer premier 5.0 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program primer premier version 5  (Premier Biosoft)
    90
    Premier Biosoft computer program primer premier version 5
    Computer Program Primer Premier Version 5, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+program+primer+premier+version+5/10__1016_slash_j__aquaculture__2005__03__041-54-12-20
    Average 90 stars, based on 1 article reviews
    computer program primer premier version 5 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program primer premier for windows  (Premier Biosoft)
    90
    Premier Biosoft computer program primer premier for windows
    Computer Program Primer Premier For Windows, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+program+primer+premier+for+windows/10__1128_slash_aem__70__6__3575___3581__2004-73-31-34
    Average 90 stars, based on 1 article reviews
    computer program primer premier for windows - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    computer program primer premier  (Premier Biosoft)
    90
    Premier Biosoft computer program primer premier
    Computer Program Primer Premier, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+program+primer+premier+for+windows/pm11721178-114-17-23
    Average 90 stars, based on 1 article reviews
    computer program primer premier - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primer premier computer program  (Premier Biosoft)
    90
    Premier Biosoft primer premier computer program
    Primer Premier Computer Program, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+premier+computer+program/computer+program+primer+premier+for+windows/pm11161768-77-6-12
    Average 90 stars, based on 1 article reviews
    primer premier computer program - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results